Fulltext – Korean Journal of Agricultural Science

Development of succinate producing Cellulomonas flavigena mutants with deleted succinate dehydrogenase gene

Heon-Hak Lee¹, Min-Ki Jeon¹, Min-Ho Yoon¹^*

¹Department of Bio-Environmental Chemistry, Chungnam National University

March 2017
Korean Journal of Agricultural Science 2017 44(1):30-39
Received Date: 16 January 2017
Accepted Date: 08 March 2017
Revised Date: 06 March 2017
DOI: 10.7744/kjoas.20170004
Check for Update!
Cited by
Citation

Abstract

This study was performed to produce succinic acid from biomass by developing mutants of Cellulomonas flavigena in which the succinate dehydrogenase gene (sdh) is deleted. For development of succinate producing mutants, the upstream and downstream regions of sdh gene from C. flavigena and antibiotic resistance gene (neo, bla) were inserted into pKC1139, and the recombinant plasmids were transformed into Escherichia coli ET12567/ pUZ8002 which is a donor strain for conjugation. C. flavigena was conjugated with the transformed E. coli ET12567/pUZ8002 to induce the deletion of sdh in chromosome of this bacteria by double-crossover recombination. Two mutants (C. flavigena H-1 and H-2), in which sdh gene was deleted in the chromosome, were constructed and confirmed by PCR. To estimate the production of succinic acid by the two mutants when the culture broth was fermented with biomass such as CMC, xylan, locust gum, and rapeseed straw; the culture broth was analyzed by HPLC analysis. The succinic acid in the culture broth was not detected as a fermentation products of all biomass. One of the reasons for this may be the conversion of succinic acid to fumaric acid by sdh genes (Cfla_1014 - Cfla_1017 or Cfla_1916 - Cfla_1918) which remained in the chromosomal DNA of C. flavigena H-1 and H-2. The other reason could be the conversion of succinyl-CoA to other metabolites by enzymes related to the bypass pathway of TCA cycle.

Keyword

Cellulomonas flavigena, conjugation, deletion, succinate dehydrogenase gene (sdh), succinic acid

Introduction

재생 가능한 바이오매스는 매우 풍부하며, 연간 1,700 억 톤 중 3.5%만이 활용되고 있다(Song and Lee, 2006). 바이오매스는 옥수수, 콩, 사탕수수 등 당․전분질계 1세대 바이오매스, 목질계 2세대 바이오매스, 미세조류와 같은 3세대 바이오매스로 분류된다. 식량자원인 당․전분질계 바이오매스는 곡물가 상승 및 식량난 부족에 따른 문제점 때문에 에너지 자원으로 이용에 어려움이 있다. 이에 따라 농업부산물 과 산림자원 등의 목질계 바이오매스가 많은 주목을 받고 있다(Nigam and Singh, 2011). 유채대는 유채유 및 바이오 디젤용 유채종자를 사용한 후

남는 부산물로 사료나 유기질 비료로서 이용되고 있으며, 바이오 에탄올 생산을 위한 바이오 에너지 자원으로 각광받고 있다(Han et al., 2009).

Succinic acid는 식품산업에서 감미료, 산도조절제로 사용되며 농업과 의약산업 등 산업적으로도 adipic acid, 1,4-butanediol, tetrahydrofuran, N-methyl pyrrolidinone, 2-pyrrolidinone과 succinate salts와 중요한 화학물의 전구물질로 사용되고, 또한 poly butyrene succinate (PBS)나 polyamides (Nylon4)와 같은 생분해성 polymer의 합성에 이용되는 산업적 가치가 큰 물질이다(Zeikus et al., 1999). 이러한 building-block의 중간물질 가능성으로 다양한 시장성을 인정받아 2004년 미국 에너지국(Department of Energy)에서 지정한 12종의 핵심 화학 원료물질(Top value added chemicals) 중 하나로 선정되었다(Werpy et al., 2004).

Succinic acid는 당의 발효 시 TCA (tricarboxylic acid cycle)의 C4 중간대사산물로 생성되는 유기산 중 하나로(Song and Lee, 2006), TCA 경로를 통해 succinic acid는 succinate dehydrogenase (sdh)에 의해 fumaric acid로 전환된다. Succinate dehydrogenase는 flavoprotein subunit, iron-sulfur subunit 그리고 작은 2개의 subunit 총 4개의 소단위로 구성되어 있는 succinic acid의 산화를 촉매하는 효소이다(Huang and Miller, 2013). 미생물에 의한 succinic acid 발효는 주로 PEP carboxylation 대사경로를 이용하는 Actinobacillus succinogenes (Pateraki et al., 2016), Mannheimia succiniciproducens (Choi et al., 2016), Anaerobiospirillum succiniciproducens (Bretz, 2015)와 같은 혐기성 미생물을 이용한 연구가 주를 이었고, 최근에는 sdh 유전자를 불활성화 시켜 fumaric acid로의 전환을 억제하여 호기적인 조건에서도 succinic acid를 생산할 수 있는 균주가 개발 되었다(Lin et al., 2005a; Lin et al., 2005b). 이와 같이 호기성조건에서도 sdh 유전자를 불활성화시켜 succinic acid를 생산하는 Escherichia coli (Li et al., 2013), Corynebacterium (Jojima et al., 2016), Saccharomyces (Rezaei et al., 2015)등 다양한 형질전환 미생물을 이용한 연구도 이루어지고 있다.

Cellulomonas 속은 Streptomyces 속과 함께 Actinobacteria 문(phylum)의 Actinomycetales 과(Order)에 속한다. Cellulomonas flavigena는 Cellulomonas속의 대표종이며 염색체의 전체염기서열이 분석되어 있고(Abt et al., 2010), cellulase를 비롯한 88종의 glucoside 분해효소를 생산한다고 알려져 있어(Kim et al., 2007; Christopherson et al., 2013), 다당류의 동시당화발효 균주로서 이용 가능성이 높다고 생각된다(Lee et al., 2016). 본 연구에서는 Streptomyces 속의 유전자조작에 사용되는 방법을 활용하여 E. coli-Streptomyces shuttle vector이며, 온도저항성 origin을 가지고 있는 vector pKC1139 (Bierman et al., 1992)와 conjugation 공여균주 인 E. coli ET12567/pUZ8002 (Paget et al., 1999)를 이용하여 섬유소분해균인 C. flavigena의 succinate dehydrolase (sdh) 유전자를 deletion 시킨 형질전환체를 개발하여 바이오매스의 발효를 통한 succinic acid 생산에 대해 연구하고자 하였다.

Materials and Methods

실험재료

LB broth, yeast extract, agar 등의 배지 성분들은 Difco (Detroit, Michigan, USA)사의 제품을 사용하였으며, Dubos broth 제조에 필요한 성분과 일반시약 및 항생제는 Sigma-Adrich (St. Louis, MO, USA)와 Junsei chemical (Tokyo, Japan)사의 제품을 이용하였다. Taq polymerase 및 제한효소 등의 유전자조작용 시약들은 Takara Clontech (Kyoto, Japan) 및 Biofact (Daejeon, Korea)사의 제품을 이용하였다.

사용 균주 및 플라스미드

본 연구에서 사용한 Cellulomonas flavigena KCTC1038는 한국미생물자원센터(KCTC)에서 분양 받아 사용하였다. C. flavigena KCTC1038은 succinate dehydrogenase gene (sdh)을 cloning 하기 위한 chromosomal DNA source로, sdh를 deletion 및 succinic acid 생산을 위한 host로 사용하였다.

Sdh cloning을 위한 TA vector로 Biofact사의 All In One^TM vector가 사용되었으며, Ampicilin resistence gene (β-lactamase, bla), kanamycin resistance gene (neomycin phosphotransferase, neo)의 template DNA로는 pUC19와 pKD4 vector를 사용하였다. pKC1139는 온도 민감성 복제기점을 가지고 있는 E. coli-Streptomyces shuttle vector로 34°C 이상에서는 방선균 세포 내에서 복제가 중단된다. pKC1139를 sdh deletion vector로 사용하였다.

균주배양

C. flavigenas는 baffled flask를 사용하여 1% 탄소원이 첨가된 Dubos broth (NaNO₃ 0.1%, K₂HPO₄․7H₂O 0.1%, MgSO₄․7H₂O 0.05%, NaCl 0.05%, yeast extract 0.05%, FeSO₄․7H₂O 0.001%)에서 30°C, 170 rpm의 조건으로 배양하였으며(Dubos, 1928), 탄소원은 기질별로 carboxylmethylcellulose (CMC), xylan, locust gum (galacto-mannan), 유채대(≤40 mesh)를 사용하였다. Escherichia coli DH5α는 cloning을 위한 host로 사용되었고, E. coli ET12567/ pUZ8002는 메틸화가 결손된 균주로 DNA 전합전달의 공여 균주로 사용되었다(Paget et al., 1999). E. coli는 LB broth (tryptone 1%, NaCl 1%, yeast extract 0.5%)에서 37°C, 170 rpm의 조건으로 배양하였다. 단, pKC1139 또는 pKC1139 유래 vector를 포함하는 E. coli는 30°C, 170 rpm의 조건으로 배양하였다(Bierman et al., 1992). 선택적 배양의 경우 배지에 ampicillin (40 µg mL^-1), kanamycin (50 µg mL^-1), apramycin (50 µg mL^-1), chloramphenicol (12.5 µg mL^-1), nalidixic acid (25 µg mL^-1). 접합전달을 위한 배지로는 1% CMC가 함유된 Dubos broth (Dubos CMC broth)에 Tryptone (10 g L^-1), 10 mM MgCl₂를 첨가하여 사용하였다.

Genomic DNA 및 plasmid DNA 분리

C. flavigena를 100 mL Dubos CMC broth에 접종하여 250 mL baffled flask에서 30°C, 170 rpm의 조건으로 진탕배양 후, 배양액 1.5 mL을 15,000 rpm, 1 min의 조건으로 원심분리하였고, HiGene^TM genomic DNA prep kit (Biofact)를 이용하여 genomic DNA를 분리하였다.

E. coli을 100 mL LB broth에 접종하여 250 mL baffled flask에서 37°C, 170 rpm의 조건으로 16 시간 진탕배양 후, 배양액 1.5 mL을 15,000 rpm, 1 min의 조건으로 원심분리하였고, HiGene^TM plasmid mini prep kit (Biofact)를 이용하여 plasmid DNA를 분리하였다.

Integration vector의 구축

sdh 유전자 deletion을 위해 C. flavigena KCTC1038 sdh 유전자의 upstream과 downstream 부분을 thermal cylcler (Applied Biosystems, USA)를 사용하여 PCR 증폭하였다. Primer는 NCBI (National Center for Biotechnology Information)의 database를 토대로 deletion할 sdh의 upstream과 downstream 400 - 1,400 bp 부분을 제작하였으며, marker로 사용할 항생제 내성유전자 또한 NCBI의 database를 토대로 pKD4, pUC19의 neo, bla 부분 유전자를 primer로 제작하였다. Oligonucleotide의 합성은 Bioneer (Daejeon, Korea)에 의뢰하였다. C. flavigena는 GC 함량이 높다는 특징을 가지고 있어 PCR 반응 시 Band Helper (Biofact)를 첨가하였다. 증폭된 DNA 단편은 1% agarose gel에 전기영동 한 후, 100 bp plus DNA ladder (Bioneer, Korea)와 비교하여 크기를 확인하였다. DNA 크기가 확인된 PCR 단편을 Del_1, Del_2, Del_3, Del_4, neo, bla라 명명하였으며 이 단편을 TA cloning 하였다. 제한효소를 이용하여 TA cloning된 plasmid로 부터 각각의 단편을 분리하고 pKC1139와 Del_1 (or Del_3), neo (or bla), Del_2 (or Del_4)의 순서로 세 가지 단편을 한번에 ligation 하여 완성된 integration vector를 pKH3neo8 (or pKH5bla9)라 명명하였다(Fig. 1). 완성된 integration vector를 E. coli DH5α에 함유시켜 증폭한 후, 최종적으로 E. coli ET12567/ pUZ8002에 형질전환 하였고, pKH3neo8을 함유하는 균주를 E. coli MK-1, 또한 pKH5bla9를 함유하는 균주를 E. coli MK-2라 명명하였다.

Fig. 1. Scheme for construction of integration vector with both deleted sdh and neo genes.

Conjugation에 의한 sdh 유전자의 deletion

C. flavigena로의 intergration vector의 전달은 공여균주인 E. coli ET12567/pUZ8002를 이용하여 수행되었다(Mazodier et al., 1989; Flett et al., 1997). 우선 intergration vector가 삽입된 E. coli MK-1, MK-2와 C. flavigena 배양액 50 mL를 원심분리(3,000 rpm, 15 min) 하여 상증액을 제거한 후, 남아있는 항생제를 제거하기 위하여 ice-cold sterile water로 2회 세척해 주었다. 두 균주를 혼합한 뒤 100 µL를 1% tryptone과 10 mM MgCl₂가 함유된 Dubos CMC agar 배지에 spreading 하였다. 30°C에서 16 - 18 시간 배양 후, 형질전환된 C. flavigena만을 배양시키기 위하여 nalidixic acid를 agar 배지 위에 overlay시켰다. 3 - 4일 후 생성된 colony를 3회 계대 배양하였다. 이는 전달된 intergration vector와 C. flavigena의 chromosomal DNA사이의 double crossover recombination 효율과 형질전환체의 유전적 안정성을 높이고자 하였다. 이 후 37°C에서 배양을 하여 intergration vector와 chromosal DNA 사이의 double crossover recombination을 유도하여 sdh 유전자를 deletion하였다. sdh 유전자가 deletion된 형질전환체는 kanamycin (200 µg mL^-1) 또는 ampicillin과 apramycin (100 µg mL^-1)을 넣은 배지에 교차배양하여 kanamycin 또는 ampicillin에 내성을 갖고, apramycin에 감수성인 형질전환체를 선별하였다. 이 균주를 C. flavigena H-1과 H-2라 명명하였다. Deletion된 형질전환체의 genomic DNA를 분리하고 PCR증폭을 통해 유전자 내 sdh deletion을 확인하였다.

Succinic acid의 분석

C. flavigena HH-1, 2의 succinic acid의 생산능을 알아보기 위하여 1% CMC, xylan, galacto-mannan를 탄소원으로 첨가된 Dubos broth를 제조하여 C. flavigena를 30°C, 170 rpm의 조건에서 5일간 배양하였다.

배양 상증액을 0.45 µm syringe filter를 이용해 여과 후, HPLC를 이용하여 배양여액 중의 succinic acid를 분석하였다. HPLC 분석에는 Agilent 1200 HPLC series (Agilent Technologies, Wilmington, DE, USA)를 사용하였다. Inertsil^® ODS-3V (3.0 × 150 mm, 5 µm, GL SCIENCES INC, Japan) column을 이용하였고, column의 온도는 40°C로 유지시켰다. 용매는 0.008 N H₂SO₄를 분당 0.2 mL min^-1의 유량으로 흘려주어 UV detector (Agilent Technologies, Wilmington, DE, USA)를 이용하여 210 nm에서 Succinic acid를 확인하였다. Succinic acid의 표준물질은 Junsei사(Japan) 에서 구입하여 사용하였다. 표준물질은 10, 20, 50, 100, 250, 500 mg L^-1 의 농도로 제조 후, 표준곡선을 작성하였고, 이를 이용하여 C. flavigena 형질전환체에 의해 생산된 succinic acid를 정량하였다.

Results and Discussion

sdh upstream, downstream의 PCR

sdh 유전자를 deletion하기 위하여 sdh (Cfla_1014 - Cfla_1017, Cfla_1916 - Cfla_1918)의 upstream (Del_1, Del_3)과 downstream (Del_2, Del_4) regions을 증폭시켰다(Fig. 2). C. flavigena의 genomic DNA는 GC 함량이 76%로 DNA의 denaturation이 잘 이루어지지 않아서 denaturation temperature를 96°C로 설정하였고, 원하는 크기로 증폭된 DNA 단편을 얻어 TA cloning 하였다. Vector에 삽입된 단편의 염기서열을 분석한 결과, 모균주의 유전자와 99% 일치하였으며 염기서열 중 nucleotides 몇 개의 불일치는 homologous recombination을 이용한 gene deletion에 영향을 미치지 않는다고 보고되어 있어(Kang and Ryu, 2009) 다음과정을 수행하였다. C. flavigena의 sdh 유전자 deletion을 확인하기 위한 marker로 kanamycin 저항 유전자와 ampicillin 저항 유전자를 pKD4와 pUC19로부터 PCR 증폭하였다. PCR 증폭된 단편을 sdh의 upstream 및 downstream과 마찬가지로 TA cloning 후, 염기서열을 분석한 결과, 100% 일치하는 염기서열을 얻었다.

Fig. 2. PCR product of upstream (Del_1, Del_3) and downstream (Del_2, Del_4) regions for sdh gene deletion from Celluomonas flavigena.

Integration vector의 구축

TA cloning 된 Del_1, Del_2, Del_3, Del_4 및 neo, bla는 제한효소 EcoRI, BamHI, HindIII를 이용하여 절단하였고, 이를 pKC1139에 삽입하여 Del_1(3)-neo (bla)–Del_2(4) cassette가 삽입된 vector를 pKH3neo8 와 pKH5bla9로 각각 명명하였다. 얻어진 Integration vector pKH3neo8과 pKH5bla9를 동일 제한효소로 절단한 후 insert DNA의 절편크기를 확인한 결과, Fig. 3에서 처럼 pKC1139, Del_1(2), neo (bla)와 Del_3(4) 유래 4개의 DNA밴드와 일치하는 것을 확인할 수 있었다. 이들을 E. coli ET12567/pUZ8002에 형질전환시켜 conjugation을 위한 공여균주로 사용하였다.

Fig. 3. Insert DNA fragment in integration vector pKH3neo8 and pKH5bla9 digested with EcoRI, BamHI and HindIII.

Lane 1, ladder; lane 2, Del_1 in TA cloning vector; lane 3, Del_2 in TA cloning vector; lane 4, Del_3 in TA cloning vector; lane 5, Del_4 in TA cloning vector; lane 6, bla in TA cloning vector; lane 7, neo in TA cloning vector; lane 8, Del_1-neo-Del_2 in pKC1139; lane 9, Del_3-bla-Del_4 in pKC1139.

Conjugation을 통한 integration vector 전달

구축된 pKH3neo8은 Cfla_1014부터 Cfla_1017까지 deletion을 위해 사용되었으며, pKH5bla9는 Cfla_1916부터 Cfla_1918까지 deletion을 위해 사용되었다. pKH3neo8을 C. flavigena에 형질전환시켜 30°C에서 배양하여 kanamycin과 nalidixic acid에 저항성을 가지는 균주를 선별하였고, 동일한 방법으로 pKH5bla9를 함유하는 형질전환체를 30°C에서 생육하는 ampicillin과 nalidixic acid에 저항성을 가지는 균주를 선별하였다. 이들 형질전환 균주들로 부터 sdh 유전자가 deletion된 균주를 선발하기 위하여 37°C에서 생육하는 ampicillin 또는 kanamycin에 내성 colony를 선별한 후, Dubos CMC broth 배지에 2일 동안 진탕 배양(30°C, 170 rpm) 하여 genomic DNA를 추출하였다. 추출한 genomic DNA를 이용하여 deletion 부위, 또는 deletion 부위 가 replacement 된 부위를 PCR 증폭하여 DNA size를 비교하였다. Primer A set (forward: 5’- GGCGAGATCGCGCTCGACGAACCGC-3’, reverse: 5’- TCATGCCCTTCCTCATCACGACGGGCACG-3’)는 Cfla_1013과 Cfla_1014에 존재하는 sequence이며, Primer B set (forward: 5’- GTCGTACGGGAGCACACGACATGATGA -3’, reverse: 5’- CCGGCCCGAGCCGGTCAGGTC -3’)는 Cfla_1017과 Cfla_1018에 존재하는 sequence이다. 즉, Cfla_1014부터 Cfla_1017까지가 제거된 형질전환체는 PCR증폭이 일어나지 않으며, 제거되지 않은 wild type에서는 825, 675 bp 크기의 PCR 단편이 생성된다. 또한 primer C set (forward: 5’- GGGCGGTGACAGGACCTCCGGC -3’, reverse: 5’- CGCACCGCCGCGGACGTAGC -3’)는 Cfla_1013 일부와 neo 그리고 Cfla_1018의 일부를 포함하는 sequence이다. 즉, integration vector와 염색체 DNA상의 sdh 유전자가 replacement된 형질전환체에서만 1,050bp 크기의 PCR단편이 생성된다. 마찬가지로 primer D set (forward : 5’- GTGCGACTGCCGCGCCCC -3’, reverse: 5’- GCGCTCGGCGGCCTTCCC -3’)은 Cfla_1915와 Cfla_1916, primer E set (forward: 5’- CTCGGGGCCGAGGAAGATCTTGAGGTT -3’, reverse: 5’- CCAGC GGCCGGCCGTGC -3’)는 Cfla_1918과 Cfla_1919, primer F set (forward: 5’- AGCATCTCCGACGCCGCC ACGAGC -3’, reverse: 5’- GGGACGCACACCACGACGGACCC -3’)는 Cfla_1915 일부와 bla 그리고 Cfla_1919일부를 포함하는 sequence로 각각의 증폭된 PCR 단편의 크기는 825, 825 그리고 1,124 bp 이다. 이들 PCR산물의 크기로 sdh 유전자의 deletion을 확인하였다. sdh 유전자가 deletion 된 C. flavigena H-1에서는 primer A와 B set에서는 PCR 증폭이 일어나지 않았으며, primer C set에서만 1,050bp의 PCR 단편이 확인되었다. 또한 C. flavigena H-2는 primer D 와 E set에서 PCR product가 생성되지 않았고, primer F set에서만 1,124 bp의 단편이 생성되었으므로, 이 결과를 통해 두 형질전환균주들의 sdh 유전자가 deletion 되었음을 입증하였다(Fig. 4).

Fig. 4. Confirmation of sdh gene deletion in Cellulomonas flavigena H-1 and H-2 by PCR.

Lane 1, ladder; lane 2, PCR amplification of C. flavigena H-1 using primer A set; lane 3, PCR amplification of C. flavigena H-1 using primer B set; lane 4, PCR amplification of C. flavigena H-1 using primer C set; lane 5, PCR amplification of C. flavigena KCTC1038 using primer A set; lane 6, PCR amplification of C. flavigena KCTC1038 using primer B set; lane 7, ladder; lane 8, PCR amplification of C. flavigena H-2 using primer D set; lane 9, PCR amplification of C. flavigena H-2 using primer E set; lane 10, PCR amplification of C. flavigena H-2 using primer F set; lane 11, PCR amplification of C. flavigena KCTC1038 using primer D set; lane 12, PCR amplification of C. flavigena KCTC1038 using primer E set.

탄소원에 따른 succinic acid 생산

Dubos 배지에 CMC, xylan, locust gum 및 유채대를 탄소원으로 C. flavigena H-1 과 H-2를 30°C 에서 5일간 배양하면서 24시간 간격으로 배양 상등액의 succinic acid 생산량을 비교, 분석하였으나 전 기간 동안 두 균주 모두 succinic acid를 생산하지 않았다(Fig. 5). 그러나 wild type인 C. flavigena KCTC1038과 C. flavigena H-1, H-2 모두 발효산물 중 succinic acid의 피크는 확인되지 않았으나, 모 균주와 형질전환체 간의 크로마토그램의 피크 패턴의 차이가 나타난 것으로 보아, sdh 유전자의 deletion으로 인해 대사산물의 변화가 나타난 것으로 추정된다. 그러나 기대했던 succinic acid가 검출되지 않은 것은, C. flavigena의 두 종류 sdh (Cfla_1014 - Cfla_1017, Cfla_1916 - Cfla_1918) 유전자 중 형질전환체는 각각 한 종류의 sdh 유전자만이 deletion된 형질전환체이므로 염색체 DNA에 남아있는 sdh (H-1은 Cfla_1916 - Cfla_1918, H-2는 Cfla_1014 - Cfla_1017) 부분에 의해 succinic acid가 fumaric acid로 전환되었기 때문으로 생각된다. 또 하나의 가능성은, C. flavigena의 대사과정 중 succinic acid의 전구체인 succinyl-CoA가 다른 대사과정에 관여하는 효소에 의해 TCA bypass 경로를 이용하여 전환되었을 가능성도 배제할 수 없다. NCBI database 검색 결과, C. flavigena에 의한 succinyl기 화합물과 succinic acid 대사와 관련된 효소가 18종이 존재하고, 또한 기능이 알려지지 않은 가설 단백질(hypothetical protein)도 1,071개 존재하는 것으로 알려져 있다(Abt et al., 2010). 따라서 C. flavigena H-1 와 H-2의 sdh 유전자가 deletion 되었음에도 불구하고 이들 형질전환체로부터 succinic acid가 검출되지 않는 원인에 대하여 추정하는 몇 가지 가능성을 확인하는 연구가 추가적으로 필요할 것으로 생각된다.

Fig. 5. HPLC chromatogram of succinic acid produced in culture broths of Cellulomonas flavigena strains.

(A) Cellulomonas flavigena H-1; (B) C. flavigena H-2; (C) C. flavigena KCTC1038 (wild type); (D) Succinic acid standard 250 ppm.

Conclusion

Cellulomonas flavigena는 88종의 glucoside 분해효소를 생산하는 대표적인 섬유소분해세균으로 알려져 있다. 본 연구에서는 Cellulomonas flavigena KCTC1038의 succinate dehydrogenase gene (sdh)이 deletion된 형질전환균주를 개발하기 위하여 C. flavigena KCTC1038 sdh 유전자의 upstream과 downstream regions, 항생제 내성유전자(neo, bla)를 온도민감성 복제기점을 가지는 pKC1139 vector에 삽입하여 재조합 plasmid pKH3neo8과 pKH5bla9를 제조한 후, 공여균주인 E. coli ET12567/pUZ8002에 형질전환 시켰다. 형질전환 E. coli와 C. flavigena를 conjugation시켜 double crossover recombination에 의한 C. flavigena의 sdh 유전자 deletion을 유도하여 pKH3neo8 유래 형질전환체 C. flavigena H-1과 pKH5bla9 유래 H-2를 얻었다. CMC, xylan, locust gum 및 유채대를 탄소원으로 C. flavigena H-1 과 H-2를 배양하여 HPLC 분석을 통해 배양 상증액의 succinic acid의 생산을 조사하였으나, 두 균주 모두 succinic acid를 생산하지 않았다. 이는 염색체 DNA에 남아있는 sdh (H-1은 Cfla_1916 - Cfla_1918, H-2는 Cfla_1014 - Cfla_1017) 부분에 의해 succinic acid가 fumaric acid로 전환되었거나, succinic acid의 전구체인 succinyl-CoA가 다른 대사과정에 관여하는 효소에 의해 TCA bypass 경로를 이용하여 전환되었기 때문으로 생각된다. 따라서 succinic acid를 생산하는 C. flavigena 균주를 개발하기 위해서는 두 종류의 sdh 유전자가 모두 deletion된 형질전환균주를 개발하는 추가적인 연구가 필요하다고 생각된다.

References

1 Abt B, Foster B, Lapidus A, Clum A, Sun H, Pukall R, Lucas S, Del Rio TG, Nolan M, Tice H, Cheng JF, Pitluck S, Liolios K, Ivanova N, Mavromatis K, Ovchinnikova G, Pati A, Goodwin L, Chen A, Palaniappan K, Land M, Hauser L Chang YJ, Jeffries CD, Rohde M, Goker M, Woyke T, Bristow J, Eisen JA, Markowitz V, Hugenholtz P, Kyrpides NC, Klenk HP. 2010. Complete genome sequence of Cellulomonas flavigena type strain (134T). Standards in Genomic Sciences 3:15-25.

2 Bierman M, Logan R, O'brien K, Seno ET, Rao RN, Schoner BE. 1992. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116:43-49.

3 Bretz K. 2015. Succinic acid production in fed-batch fermentation of Anaerobiospirillum succiniciproducens using glycerol as carbon source. Chemical Engineering & Technology 38:1659-1664.

4 Choi S, Song H, Lim SW, Kim TY, Ahn JH, Lee JW, Lee MH, Lee SY. 2016. Highly selective production of succinic acid by metabolically engineered Mannheimia succiniciproducens and its efficient purification. Biotechnology and Bioengineering 113: 2168-2177.

5 Christopherson MR, Suen G, Bramhacharya S, Jewell KA, Aylward FO, Mead D, Brumm PJ. 2013. The genome sequences of Cellulomonas fimi and “Cellvibrio gilvus” reveal the cellulolytic strategies of two facultative anaerobes, transfer of “Cellvibrio gilvus” to the genus Cellulomonas, and proposal of Cellulomonas gilvus sp. nov. PloS One 8:e53954.

6 Dubos RJ. 1928. The decomposition of cellulose by aerobic bacteria. Journal of bacteriology, 15: 223.

7 Flett F, Mersinias V, Smith CP. 1997. High efficiency intergeneric conjugal transfer of plasmid DNA from Escherichia coli to methyl DNA-restricting streptomycetes. FEMS Microbiology Letters 155:223-229.

8 Han JG, Oh SH, Jeong MH, Kim SS, Seo HB, Jeong KH, Jang YS, Kim IC, Lee HY. 2009. Two-step high temperature pretreatment process for bioethanol production from rape stems. KSBB Journal 24: 489-494. [in Korean]

9 Huang S, Millar AH. 2013. Succinate dehydrogenase: The complex roles of a simple enzyme. Current Opinion in Plant Biology 16:344-349.

10 Jojima T, Noburyu R, Suda M, Okino S, Yukawa H, Inui M. 2016. Improving process yield in succinic acid production by cell recycling of recombinant Corynebacterium glutamicum. Fermentation 2:5.

11 Kang HW, Ryu YW. 2009. Inhibition of oligomycin biosynthesis by olmA5 gene knock-out in Streptomyces avermitilis. KSBB Journal 24:279-286. [in Korean]

12 Kim MS, Yoon MH, Choi WY. 2007. Taxonomic studies on the cellulolytic bacterium Cellulomonas uda CS 1-1. CNU Journal of Agricultural Science 34:99-109. [in Korean]

13 Lee HH, Jeon MK, Yoon MH. 2016. Pretreatment and enzymatic saccharification process of rapeseed straw for production of bioethanol. Korean Journal of Agricultural Science 43:641-649. [in Korean]

14 Li N, Zhang B, Chen T, Wang Z, Tang YJ, Zhao X. 2013. Directed pathway evolution of the glyoxylate shunt in Escherichia coli for improved aerobic succinate production from glycerol. Journal of Industrial Microbiology & Biotechnology, 40:1461-1475.

15 Lin H, Bennett GN, San KY. 2005a. Metabolic engineering of aerobic succinate production systems in Escherichia coli to improve process productivity and achieve the maximum theoretical succinate yield. Metabolic Engineering 7:116-127.

16 Lin H, Bennett GN, San KY. 2005b. Fed-batch culture of a metabolically engineered Escherichia coli strain designed for high-level succinate production and yield under aerobic conditions. Biotechnology and Bioengineering 90:775-779.

17 Mazodier P, Petter R, Thompson C. 1989. Intergeneric conjugation between Escherichia coli and Streptomyces species. Journal of Bacteriology 171:3583-3585.

18 Nigam PS, Singh A. 2011. Production of liquid biofuels from renewable resources. Progress in Energy and Combustion Science 37:52-68.

19 Paget MS, Chamberlin L, Atrih A, Foster SJ, Buttner MJ. 1999. Evidence that the extracytoplasmic function sigma factor ςE is required for normal cell wall structure in Streptomyces coelicolor A3 (2). Journal of Bacteriology 181:204-211.

20 Pateraki C, Patsalou M, Vlysidis A, Kopsahelis N, Webb C, Koutinas AA, Koutinas M. 2016. Actinobacillus succinogenes: Advances on succinic acid production and prospects for development of integrated biorefineries. Biochemical Engineering Journal 112:285-303.

21 Rezaei MN, Aslankoohi E, Verstrepen KJ, Courtin CM. 2015. Contribution of the tricarboxylic acid (TCA) cycle and the glyoxylate shunt in Saccharomyces cerevisiae to succinic acid production during dough fermentation. International Journal of Food Microbiology 204:24-32.

22 Song H, Lee SY. 2006. Production of succinic acid by bacterial fermentation. Enzyme and Microbial Technology 39:352-361.

23 Werpy T, Petersen G, Aden A, Bozell J, Holladay J, White J, Manheim A, Elliot D, Lasure L, Jones S, Gerber M, Ibsen K, Lumberg L, Kelly S. 2004. Top value added chemicals from biomass. Volume 1-Results of screening for potential candidates from sugars and synthesis gas (No. DOE/GO-102004-1992). Department of Energy Washington DC.

24 Zeikus JG, Jain MK, Elankovan P. 1999. Biotechnology of succinic acid production and markets for derived industrial products. Applied Microbiology and Biotechnology 51:545-552.