Introduction
It is well documented that intensive selection for increased milk yield led to decline in the reproductive efficiency of dairy cattle, and genome-wide association study (GWAS) identified single nucleotide polymorphisms (SNPs) in candidate genes associated with reproductive performance including bull fertility, fertilization, preimplantation embryo development (Penagaricano and Khatib, 2012; Penagaricano et al., 2012; Cochran et al., 2013a; Cochran et al., 2013b; Penagaricano et al., 2013). Particularly, Cochran et al. (2013a) reported SNPs associated with daughter pregnancy rate, heifer conception rate, cow conception rate, productive life, milk yield in Holstein cattle. However, GWAS studies of reproduction traits were mainly performed in dairy cattle because of economic impact of reproductive performance and breeding strategies ( De Vries, 2006; Galvão et al., 2013; Azizian et al., 2016) rather than in beef cattle. Recently, we reported that Korean native cattle, Hanwoo showed lower reproductive performance, for example calving interval was increased 4.3% and pregnancy rate was decreased about up-to 2.8% year-on-year (Cho et al., 2016; Choi and Cho, 2016).
Here, we postulated that the decline in the reproductive performance in Hanwoo is due to intensive breeding programs using artificial insemination (AI) for economic purpose (Lim et al., 2016). In this context, we carried out in silico studies to select candidate genes associated with heifer pregnancy rate in Korean native cattle based on previous findings in dairy cattle (Cochran et al., 2013a; Ortega et al., 2017) and selected genes (WBP1 and PARM1) containing non-synonymous (missense) SNPs because the amino acid substitutions may have more functional impact on reproductive trait. In this study, we employed a new approach based on high resolution melting (HRM) that is a rapid, reliable and robust method (Garritano et al., 2009; Kysel’ová et al., 2012).
Materials and Methods
Genomic DNA isolation and HRM reaction
To develop the HRM method, we analysed a total of 29 Korean native cattle, Hanwoo from a university farm (Chungyang, Korea). DNA was extracted from whole blood samples using standard protocols for DNA Blood & Tissue kit (Qiagen, Germany). High-resolution melting analysis primer WBP 1 F (5′- ccagcctatgaggatgtggt-3′), WBP1 R (5′- acgtcttccacgtttgttcc-3′), PARM 1 F (5′- cacactcacctcccctcaag -3′), PARM1 R (5′- agatggaacctcaggtggtg -3′) were designed from the bovine genomic sequence and dbSNP (WBP1 rs134282828; PARM1 rs111027720) using the program Beacon Designer (PREMIER Biosoft International, CA, USA). Reactions were run in a volume of 25 μL using Qiagen Type-it® HRM™ PCR mix (Qiagen, Germany). Each reaction contained final concentrations of 1x HRM Type-it™ mix (Qiagen, UK) and 0.7 μM forward and reverse primer (for each target). Each sample was tested in duplicate. Reactions were run on a Qiagen Rotorgene-Q 5-plex machine (Qiagen, Germany) with temperature cycling parameters for the amplification stage being on hold at 95℃ for 5 minutes, followed by 40 cycles of 95℃ for 10 seconds, 55℃ for 30 seconds, and 72℃ for 20 seconds. For the HRM stage, fluorescence recordings were made over the range of 65 - 95℃ by increments of 0.1℃ for 2 seconds. A normalised graph was generated using normalisation regions of 73 - 75℃ and 86 - 88℃.
Results and Discussion
We carried out HRM assay for genotype of WBP1 and PARM1. SNP of WBP is missense variant in which ACT is changed into CCT, consequently amino acid residue Threonine is changed into Proline. Interestingly, in the group of heifers that are pregnant after one AI service, a high proportion of heifers have AA while lower conception or failed heifers have hetero GA or GG (Table 1). However, we did not find relationship between PARM1 and conception rates of heifers. A recent study demonstrated depletion of WBP1 decreased the blastocyst development with a decrease number of trophectoderm cells in the bovine blastocyst (Ortega et al., 2017), suggesting that changes of protein folding pattern by an amino acid substitution (Thr-Pro) may affect protein-protein interaction during embryo development.
Conclusion
In line with a loss of function study of WBP1 in dairy cattle, our HRM analysis demonstrated that WBP1 is closely related with conception and maintenance of pregnancy in Korean native beef cattle as well. In summary, our results indicated that genetic variation of WBP1 can be used as a selective marker gene for cattle breeding programs to improve reproductive performance and minimize cost of AI. In addition, HRM assay is able to clearly distinguish a single base variance and can be used for common SNP genotypes rapidly and cost effectively when the targets are selected.
