Population density and internal distribution range of Erwinia amylovora in apple tree branches
PLANT&FOREST

Population density and internal distribution range of Erwinia amylovora in apple tree branches

Mi-Hyun Lee1,  Yong Hwan Lee1*
1Crop Protection Division, National Institute of Agricultural Sciences, Wanju 55365, Korea

  49(4):881-892
Received Date: 24 May 2022
Revised Date: 19 September 2022
Accepted Date: 17 November 2022
DOI: 10.7744/kjoas.20220080
Check for Update!
Cited by
Citation

Abstract

Fire blight in apple and pear orchards, caused by Erwinia amylovora, is a global problem. Ongoing outbreaks have occurred since 2015. In 2020, 744 orchards were infected compared with 43 orchards in 2015 in Korea. When are insufficient. In Korea, all host plants in infected orchards are buried deeply with lime to eradicate the E. amylovora outbreak within a few days. Apple trees with infected trunks and branches and twigs with infected leaves and infected blooms were collected from an apple orchard in Chungju, Chungbuk province, where fire blight occurred in 2020. We used these samples to investigate the population density and internal distribution of E. amylovora on infected branches and twigs during early season infections. Infected branches and twigs were cut at 10 cm intervals from the infected site, and E. amylovora was isolated from tissue lysates to measure population density (colony-forming unit [CFU]·mL-1). The polymerase chain reaction was performed on genomic DNA using E. amylovora specific primers. Real-time polymerase chain reaction (PCR) was performed to detect E. amylovora in asymptomatic tissue. The objective of these assays was to collect data relevant to the removal of branches from infected trees during early season infection. In infected branches, high densities of greater than 106 CFU·mL-1 E. amylovora were detected within 20 cm of the infected sites. Low densities ranging from 102 to 106 CFU·mL-1 E. amylovora were found in asymptomatic tissues at distances of 40 - 75 cm from an infection site.

Keyword

Apple branch, Erwinia amylovora, fire blight

Introduction

Fire blight caused by Erwinia amylovora has become a concern due to the worldwide spread of outbreaks. In 2015, it was identified in apple, Asian pear, and Chinese quince in Korea (Myung et al., 2016a; 2016b; Park et al., 2016). Since the 2015 outbreak of fire blight in Korea, it has spread to several areas of apple and pear orchards, despite intensive efforts to manage the disease. In 2020, the disease occurred in 744 orchards, severely affecting the apple and pear industries in Korea. Recently, an outbreak of the disease has also been observed in apricot (Prunus armeniaca) trees located near an apple orchard where fire blight has occurred (Lee et al., 2021). To manage fire blight, the Korean government stipulates that all host plants in disease-causing orchards be removed. Since 2020, only infected trees have been partially removed from orchards, depending on the percentage of diseased trees in orchards.

E. amylovora is virulent and capable of rapid systemic movement among plant hosts. Numerous studies have measured the internal migration of E. amylovora through the plant vascular system. The pathogen spreads through the xylem after being inoculated into a damaged plant vascular system (Suhayda and Goodman, 1981a) and can move through the phloem (Lewis and Goodman, 1965). Systemic infection of the pathogen typically begins in blossoms or shoot blight. Canker on trunk and stem may cause adjacence stem infections. Moreover, it is reported that E. amylovora can spread from blighted blossoms and blighted shoots to the central leader and rootstock of the tree (van der Zwet et al., 2012).

In many countries, fire blight outbreaks are controlled by removing diseased branches. An effective way to prevent the spread of bacterial disease is pruning infected branches before the disease becomes more active. Successful removal of fire blight infections occurs in winter when E. amylovora is no longer spreading through the tree. E. amylovora can reside in asymptomatic apple and pear tissues, which may explain why fire blight can appear unexpectedly (Gowda and Goodman, 1970; Keil and van der Zwet, 1972; Suhayda and Goodman, 1981b; McManus and Jones, 1994; Smith, 2002). Shortcutting too close to the infected site to remove all the infected tissue is a greater risk because E. amylovora can reside in asymptomatic apple and pear tissues. Trees with latent infections can develop symptoms under suitable conditions and infect adjacent trees, which is particularly harmful to commercial orchards (van der Zwet, 1983, 1996; Ge and van der Zwet, 1996; Crepel and Maes, 2000). Thus, it is necessary to certify the internal distribution range of E. amylovora during the early season of infection of leaves and bloom in branches.

E. amylovora is identified using morphological or DNA-based methodologies such as polymerase chain reaction (PCR) and real-time PCR (Svircev et al., 2009; Hinze et al., 2016). Real-time PCR is a rapid and sensitive method that detects low densities of E. amylovora on asymptomatic apple and pear tissue within a few hours (Higuchi et al., 1993). Sensitive and species-specific polymerase chain reaction (real-time PCR) assays make it feasible to detect and quantitate low-density infections of E. amylovora in asymptomatic tissues. The objective of this study was to determine the distribution range of E. amylovora around early season infection sites in apple tree branches. In addition, low-level infections of E. amylovora in asymptomatic tissues were detected and quantified using real-time PCR.

Materials and Methods

Plant material

Experiments were performed with samples obtained from apple trees with the infected trunks, blossoms, and leaves. Infected branches and twigs with infected leaves and blossoms were collected from an apple orchard in Chungju, Chungbuk province, where fire blight occurred in 2020. Samples (up to 1 m long) of branches and twigs with the infected blossoms and leaves were also collected. Samples of the infected site and adjacent limbs were collected from apple trees with infected trunks.

Isolation and identification of E. amylovora

To determine whether E. amylovora was present in the tissues of the infected trunk, blossoms, and leaves, samples were surface-sterilized three times with 70% EtOH. Limbs, branches, and twigs were then cut at 10 cm intervals from the infected area with a sanitized scalpel. Tissues were shaved off the bark of each sample and macerated in 500 µL of sterile water in a sterile 1.5 mL centrifuge tube. E. amylovora in tissue lysates was quantified by serial dilution on King’s medium B, plated in triplicate, and reported as colony-forming units per mL (CFU·mL-1). Isolation tests were repeated three times and yielded identical results.

Plates were stored in a 27℃ incubator for 2 days. CFU was counted for each dilution and averaged to determine the density of E. amylovora in the sample. When typical colonies were observed, one representative colony per plate was subjected to PCR to confirm E. amylovora. Colonies were assayed by PCR using primer sets A/B (Bereswill et al., 1992).

PCR and real-time PCR assays

Apple tree samples were isolated using a Genomic DNA extraction Mini kit (Qiagen, Hilden, Germany). Aliquots (2 µL) were amplified by PCR using primers A (5´-CGGTTTTTAACGCTGGG-3´) and B (5´-GGGCAAATACTCGGATT-3´). The thermal cycler (BioRad, California, USA) reaction conditions were performed as previously described (Bereswill et al., 1992). PCR products were separated on a 1% agarose gel in TBE buffer. Gels were stained with Dyne Loading Star (0.1 mg·L-1), and DNA was visualized under a UV transilluminator.

Real-time PCR analyses were performed using primers G1 (5′‐CCTGCATAAATCACC GCTGACAGCTCAATG‐3′) and G2 (5′‐GCTACCACTGATCGCTCGAATCAAATCGGC‐3′) as previously described (Taylor et al., 2001), and the amplification products were detected with SYBR Green dye. The G1 and G2 primers (also called pEA71 primers) target a specific region of the chromosomal of E. amylovora. Amplifications were performed in a 20 µL reaction volume containing 1 µL template (sample), 10 µL of 2X reaction mix (IQ SYBR Green SuperMix, BioRad, California, USA), and 0.2 µM of each primer. Real-time PCR analyses were repeated three times and yielded identical results. The amplification conditions included an initial denaturation step at 95℃ for 5 min and 40 amplification cycles (5 sec at 95 and 30 sec at 65℃). A melting curve analysis was performed from 65℃ to 95℃, with a 0.5℃ increment with 15 sec hold on the first step and 5 sec hold on the next steps.

Results

Properties of real-time PCR for E. amylovora detection

Real-time PCR analyses were performed using primers G1 and G2 using a modification of the conditions described by Taylor et al. (2001). Although a fluorescent signal was observed for E. amylovora, this signal was confirmed by melting peak (Tm 86.5 - 87℃) and melt-curve analyses (Supplementary Fig. 1a and b). To estimate the sensitivity of E. amylovora detection, suspensions of E. amylovora (4.8 × 107 CFU·mL-1) were prepared. The suspensions were then serially diluted ten times, and each dilution was used as the template in PCR and real-time PCR reactions. Real-time PCR had a sensitivity threshold of 4.8 × 102 CFU·mL-1 per reaction (Supplementary Fig. 1c - e). The sensitivity of PCR was 100 times less than real-time PCR (data not shown). The maximum number of threshold cycles to positively detect E. amylovora DNA with real-time PCR was 34 cycles, and the R2 value was 0.9941.

http://dam.zipot.com:8080/sites/kjoas/images/N0030490421_image/Fig_KJOAS_49_04_21_F1.png

Fig. 1. The population density of Erwinia amylovora on the infected trunk in an apple orchard where a fire blight occurred in Korea in 2020. (a, b) The selected tree (a) and a higher magnification of the branches (b) were collected for analysis. The red arrow (a) and sample number 1 (b) indicate the infected site. Circles (a) and sample numbers 2 - 5 (b) indicates the locations sampled on adjacent branches. (c) Population densities of E. amylovora in samples 1 - 5. (d) DNA amplification by polymerase chain reaction (PCR). PCR products were fractionated by agarose gel electrophoresis and visualized. CFU, colony-forming unit; M, 1 kb ladder; P, positive control; N, negative control; 1 - 5, sample numbers.

Population density and internal distribution range of E. amylovora in an apple tree with an infected trunk

Samples have collected a tree with an infected trunk (Fig. 1a, red arrow) and sampling sites were numbered consecutively in the tree. Samples were collected from the infected trunk (Fig 1b; sample number 1) and four asymptomatic limbs (Fig. 1a, red circles; Fig 1b, sample numbers 2 - 5) attached to the infected trunk. The presence and population density of E. amylovora in each sample was confirmed by measuring the colony forming unit.

E. amylovora was isolated on King’s medium B from tissue lysates of each sample (Fig. 1a and 1b). The population density of E. amylovora ranged from approximately 4 × 106 to 2 × 106 CFU·mL-1, and as the distance from the infected site increased, the density decreased (Fig. 1c). E. amylovora was detected in the infected site of the trunk (sample 1) and the two limbs (samples 2 and 3) adjacent to the infected site, but not in the two distant limbs (samples 4 and 5) (Fig. 1d) by PCR assay.

Population density and internal distribution range of E. amylovora in apple branches and twigs with infected leaves

Twig and branches infected with E. amylovora were collected, and cut at 10 cm intervals from the infected site and the population densities of E. amylovora were measured (Figs. 2 and 3). Sampling sites were numbered consecutively in twigs and branches. E. amylovora was isolated in the infected site (Fig. 2a, red arrow, sample 4) from the 55 cm twig with infected leaves and a sample 10 cm away from the infected site (Fig. 2a, sample 3) at population densities of 1 × 107 and 5 × 106 CFU·mL-1, respectively (Fig. 2b). The PCR assays were consistent with the population density results (Fig. 2c). Real-time PCR (Table 1) yielded positive signals for all tested samples at the infected twigs and the number of threshold cycles was more than 31 at the site (samples 1, 2, and 5) not detected by PCR assay, respectively.

http://dam.zipot.com:8080/sites/kjoas/images/N0030490421_image/Fig_KJOAS_49_04_21_F2.png

Fig. 2. The population density of Erwinia amylovora on branches with infected leaves. (a) The infected site of the 55 cm twig is marked with a red arrow, and each collection site is indicated with a sample number (1 - 5). (b) Population densities of E. amylovora on samples 1 - 5; (c) DNA amplification by polymerase chain reaction (PCR). PCR products were fractionated by agarose gel and visualized. CFU, colony-forming unit; M, 1 kb ladder; P, positive control; N, negative control; 1 - 5, sample numbers.

http://dam.zipot.com:8080/sites/kjoas/images/N0030490421_image/Fig_KJOAS_49_04_21_F3.png

Fig. 3. The population density of Erwinia amylovora on the branch with infected leaves. (a) The infected site of the 75 cm branch is marked with a red arrow, and each collection site is indicated with a sample number (1 - 16). (b) Population densities of E. amylovora on samples 1 - 16. (c) DNA amplification by polymerase chain reaction (PCR). PCR products were fractionated on agarose gel electrophoresis and visualized. CFU, colony-forming unit; M, 1 kb ladder; P, positive control; N, negative control; 1 - 16, sample numbers.

Table 1. Real-time PCR results of infected apple branches and twig.http://dam.zipot.com:8080/sites/kjoas/images/N0030490421_image/Table_KJOAS_49_04_21_T1.png

PCR, polymerase chain reaction; Ct, cycle threshold; SD, standard deviation; NA, not applicable; +, positive; -, negative.

E. amylovora was isolated from a 75 cm branch with infected leave (Fig. 3a, red arrow, sample 1) and the adjacent branch site (Fig. 3a, sample 2) at population densities of approximately 1 × 107 and 2 × 107 CFU·mL-1, respectively (Fig. 3b). The PCR assays were consistent with the population density results of branch samples (Fig. 3c). Real-time PCR (Table 1) yielded positive signals with threshold cycles of 19.15 ± 0.15 - 33.51 ± 0.48 for samples isolated from the branch with infected leaves (Fig. 3a, sample numbers 1 - 5), but not in samples from other sites (Fig. 3a, samples 6 - 16). These results demonstrated that E. amylovora was internally distributed up to 75 cm from the infected site (sample 1) on the branch.

Population density and internal distribution range of E. amylovora in apple branches with infected blooms

Branches with infected blooms were collected and cut at 10 cm intervals to investigate the population density of E. amylovora (Figs. 4 and 5). E. amylovora was isolated from the 111 cm branch at the bloom infected sites (Fig. 4a, red arrows, sample numbers 1 and 3) and the adjacent branch sites attached to the infected blooms (Fig. 4a, sample numbers 2 and 4), a sample 35 cm away from the infected site (Fig. 4a, sample 6), and a branch sample 10 cm away from the infected branch (Fig. 4a, sample 7). The population densities of isolated E. amylovora ranged from approximately 2 × 106 to 5 × 106 CFU·mL-1 (Fig. 4b), and the PCR assay results were consistent with the population density results (Fig. 4c). E. amylovora was detected in the branch containing the infected sites (samples 1 - 6) and the adjacent branch (samples 7 - 9) using real-time PCR (Table 1), but not in samples from other sites (samples 10 - 12). Samples 8 and 9, which were not positive for E. amylovora by PCR, were detected at 32.33 ± 0.45 and 33.40 ± 0.34 threshold cycles by real-time PCR, respectively (Table 1).

http://dam.zipot.com:8080/sites/kjoas/images/N0030490421_image/Fig_KJOAS_49_04_21_F4.png

Fig. 4. The population density of Erwinia amylovora on the branch with infected blooms. (a) The infected site of the 111 cm branch is marked with a red arrow, and each collection site is indicated with a sample number (1 - 12). (b) Population densities of E. amylovora on samples 1 - 12. (c) DNA amplification by polymerase chain reaction (PCR). PCR products were fractionated by agarose gel electrophoresis and visualized. CFU, colony-forming unit; M, 1 kb ladder; P, positive control; N, negative control; 1 - 12, sample numbers.

E. amylovora was isolated from the 85 cm branch with infected blooms at the infected site (Fig. 5a, red arrow, sample 1), an adjacent site (Fig. 5a, sample 2), and in samples 3, 6, and 7 (Fig. 5a) at population densities ranging from approximately 6 × 107 to 2 × 107 CFU·mL-1, respectively (Fig. 5b). Using real-time PCR, E. amylovora was detected in samples 4 - 5, and samples 8 - 14, which were not positive in the PCR assay (Table 1). The real-time PCR results confirm that E. amylovora was distributed up to 40 - 65 cm from the infected sites at low density.

http://dam.zipot.com:8080/sites/kjoas/images/N0030490421_image/Fig_KJOAS_49_04_21_F5.png

Fig. 5. The population density of Erwinia amylovora on the branch with infected blooms. (a) The infected site of the 85 cm branch is marked with a red arrow, and each collection site is indicated with a sample number (1 - 15). (b) Population densities of E. amylovora on samples 1 - 15. (c) DNA amplification by polymerase chain reaction (PCR). PCR products were fractionated by agarose gel electrophoresis and visualized. CFU, colony-forming unit; M, 1 kb ladder; P, positive control; N, negative control; 1 - 15, sample numbers.

Discussion

E. amylovora is registered as a quarantined pathogen by the Animal and Plant Quarantine Agency (APQA) of Korea because fire blight has a major impact on the domestic apple and pear industries. Since the 2015 outbreak in Korea, the complete eradication of E. amylovora is of the utmost importance. Although E. amylovora is an important problem in Korea, there is insufficient research on the population density and internal distribution range of E. amylovora in infected trees to develop targeted but effective responses to outbreaks in orchards.

In many regions, effective control of fire blight by pruning requires that cuts be made 30 - 35 cm below the visible end of the expanding canker and those between in winter (Dellagi et al., 1998; Kunz et al., 2011; Johnson and Temple, 2013; Granatstein, 2014). In early season infection, removal of shoot blight or bloom blight infections must be done very carefully. High-density populations of E. amylovora are present in the branches and twigs with infected shoots and blooms, and these bacteria are capable of moving very quickly through asymptomatic tissue in growing season. Despite the importance of detection in asymptomatic tissue in early season infection, tools for detection of E. amylovora have been restricted to population density (CFU·mL-1) and PCR assay. It is necessary to assay for E. amylovora in asymptomatic tissues using real-time PCR.

Real-time PCR assays are a fast and sensitive method for quantifying a pathogen that can detect low-level infections of E. amylovora in asymptomatic tissues. To detect E. amylovora by PCR method, A and B primer in pEA29 plasmid was used (Bereswill et al., 1992), and G1 and G2 primer in chromosomal DNA were used in real-time PCR method (Taylor et al., 2001). The limit of sensitivity for detecting E. amylovora by PCR with primers A and B has 4.8 × 104 cells. The real-time PCR with primers G1 and G2 improved sensitivity of 100 folds compared with PCR (data not shown).

This study is to create basic data by investigating methods of removing branches from infected trees during early season infection. E. amylovora generally grew to higher population levels of 106 - 107 CFU·mL-1 at the infection site on branches in early season infection. E. amylovora was detected in the asymptomatic limbs of the tree with an infected trunk. Tree with the infected trunk of E. amylovora was infected to the adjacent limbs, accordingly, internal distribution occurred sporadically (Fig. 2). The blooms blight appeared only in sample number 1 in Fig. 5, and are thought to have been infected and moved from number 1 to 4, 5, 6, 7, 8. However, the population density of E. amylovora in sample number 6 and 7 is higher than in sample number 4, indicating that the site may be an infection site.

Conclusion

This study is to create basic data by investigating methods of removing branches from infected trees during early season infection. E. amylovora generally grew to higher population levels of 106 - 107 CFU·mL-1 in infection sites in branches in early season infection. This study focused on determining the distribution range of E. amylovora in the infected trees of the orchard by performing isolation and population density assays using PCR and real-time PCR methods. Real-time PCR was performed for complete removal to clarify the low internal population within the tree. E. amylovora was detected in the asymptomatic limbs of a tree with the infected trunk. Tree with the infected trunk of E. amylovora was infected to the adjacent limbs, accordingly, internal distribution occurred sporadically. As stated above, E. amylovora was present 40 - 75 cm by low density in branches infected with leaves and blooms in early season infection.

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This work was supported by a grant from the agenda program (PJ01530202) Rural Development Administration, Republic of Korea

References

1 Bereswill S, Pahl A, Bellemann P, Zeller W, Geider K. 1992. Sensitive and species-specific detection of Erwinia amylovora by polymerase chain reaction analysis. Applied and Environmental Microbiology 58:3522-3526.  

2 Crepel C, Maes M. 2000. Hibernation of the fire blight pathogen Erwinia amylovora in host plants. Mededelingen-Faculteit Landbouwkundige en Toegepaste Biologische Wetenschappen, Universiteit Gent 65:19-25.  

3 David Granatstein. 2014. Fire blight–current products, research grants and regulatory status. Accessed in http://tfrec.cahnrs.wsu.edu on 7 December 2021.  

4 Dellagi A, Brisset MN, Paulin JP, Expert D. 1998. Dual role of desferrioxamine in E. amylovora pathogenicity. Molecular Plant Microbe Interactions 11:734-742.  

5 Ge Q, van der Zwet T. 1996. Persistence and recovery of endophytic Erwinia amylovora in apparently healthy apple tissues. Acta Horticulturae 411:29-34.  

6 Gowda SS, Goodman RN. 1970. Movement and persistence of Erwinia amylovora in shoot, stem, and root of apple. Plant Disease Reporter 54:576-580.  

7 Higuchi R, Fockler C, Dollinger G, Watson R. 1993. Kinetic PCR analysis: Real-time monitoring of DNA amplification reactions. Nature Biotechnology 11:1026-1030.  

8 Hinze M, Kohla L, Kunz S, Weißhaupt S, Ernst M, Schmid RA, Voegele T. 2016. Real-time PCR detection of Erwinia amylovora on blossoms correlates with subsequent fire blight incidence. Plant Pathology 65:462-469.  

9 Johnson KB, Temple T. 2013. Evaluation of strategies for fire blight control in organic pome fruit without antibiotics. Plant Disease 97:402-409.  

10 Keil HL, van der Zwet T. 1972. Recovery of Erwinia amylovora from symptomless stems and shoots of Jonathan apple and Barlett pear trees. Phytopathology 62:39-42.  

11 Kunz S, Schmitt A, Haug P. 2011. Development of strategies for fire blight control in organic fruit growing. Acta Horticulturae 896:431-436.  

12 Lee MH, Ji SH, Ham H, Kong HG, Park DS, Lee YH. 2021. First report of fire blight of apricot (Prunus armeniaca) caused by Erwinia amylovora in Korea. Plant Disease 105:696.  

13 Lewis S, Goodman RN. 1965. Mode of penetration and movement of fire blight bacteria in apple leaf and stem tissue. Phytopathology 55:719-723.  

14 McManus PS, Jones AL. 1994. Role of wind-driven rain, aerosols, and contaminated budwood in incidence and spatial pattern of fire blight in an apple nursery. Plant Disease 78:1059-1066.  

15 Myung IS, Lee JY, Yun MJ, Lee YH, Park DH, Oh CS. 2016a. Fire blight of apple, caused by Erwinia amylovora, a new disease in Korea. Plant Disease 100:1774.  

16 Myung IS, Yun MJ, Lee YH, Kim GD, Lee YK. 2016b. First report of fire blight caused by Erwinia amylovora on Chinese quince in South Korea. Plant Disease 100:2521.  

17 Park DH, Yu JG, Oh EJ, Han KS, Yea MC, Lee SJ, Myung IS, Shim HS, Oh CS. 2016. First report of fire blight disease on Asian pear caused by Erwinia amylovora in Korea. Plant Disease 100:1946.  

18 Smith TJ. 2002. The tree-season evolution of a fire blight outbreak in a nursery using an asymptomatic apple budwood source contaminated with Erwinia amylovora. Acta Horticulturae 590:109-113.  

19 Suhayda CG, Goodman RN. 1981a. Early proliferation and migration and subsequent xylem occlusion by Erwinia amylovora and the fate of its extracellular polysaccharide (EPS) in apple shoots. Phytopathology 71:697-707.  

20 Suhayda CG, Goodman RN. 1981b. Infection courts and systemic movement of 32P-labeled Erwinia amylovora in apple petioles and stems. Phytopathology 79:656-660.  

21 Svircev A, Kim WS, Lehman S, Castle A. 2009. Erwinia amylovora: modern methods for detection and differentiation. Methods in Molecular Biology 508:115-129.  

22 Taylor RK, Guilford PJ, Clark RG, Hale CN, Forster RLS. 2001. Detection of Erwinia amylovora in plant material using novel polymerase chain reaction (PCR) primers. New Zealand Journal of Crop and Horticultural Science 29:35-43.  

23 van der Zwet T. 1983. Occurrence of fire blight in commercial pear seedling rootstocks following budding with symptomless scionwood (Abstr). Phytopathology 73:969.  

24 van der Zwet T. 1996. Presence of Erwinia amylovora in apparently healthy nursery propagating material. Acta Horticulturae 411:127-130.  

25 van der Zwet T, Orolaza-Halbrendt N, Zeller W. 2012. Fire blight history, biolgy, and management. pp. 37-44, 305-332. American Phytopahtological Society, ST. Paul, MN, USA.